Contents
Download PDF
pdf Download XML
82 Views
7 Downloads
Share this article
Research Article | Volume 6 Issue 2 (July-December, 2025) | Pages 1 - 6
Serum Levels and DNA Methylation Status in Promoter of INF-γ in Patients with Graves' Disease
 ,
 ,
 ,
1
College of Medicine, Al-Qadisiya University, Iraq
2
3College of Medicine, Al-Qadisiya University, Iraq
3
Al-Diwaniya Health Directorate, Iraq
Under a Creative Commons license
Open Access
Received
Feb. 19, 2025
Revised
March 28, 2025
Accepted
July 7, 2025
Published
Aug. 5, 2025
Abstract

Graves' disease (GD) represents one of the most prevalent autoimmune disorders affecting the thyroid gland. Our investigation aimed to evaluate serum levels and the DNA methylation in the promoter regions of INF-γ in patients with GD compared to healthy controls. Methods: Blood samples were collected to measure serum levels of TSH, TPO antibodies, and cytokines (INF-γ), followed by DNA extraction and bisulfite conversion for methylation analysis using Methylation-Specific PCR (MSP). Results: Non-significant differences were noted between groups regarding age distribution or gender. Serum analysis revealed significantly lower mean TSH levels in GD patients, Additionally, there is statistically significant increase in INF-γ among GD patients compared to controls. Analysis of DNA methylation patterns showed hypomethylated INF-γ promoter regions with statistically non-significant difference between the two groups. Conclusion: INF-γ is elevated significantly in GD patients and promoter regions were hypomethylated, although the difference in methylation did not reach statistical significance. This finding indicates that methylation in INF-γ promoter may has a critical role in the gene regulation.

Keywords
INTRODUCTION

Autoimmune thyroid diseases (AITDs) are autoimmune disorders affecting thyroid gland. Hyperthyroidism, Graves’ disease (GD), and hypothyroidism, Hashimoto’s thyroiditis (HT), are the most common forms of AITDs, GD presents clinically as hyperthyroidism due to the production of thyroid-stimulating autoantibodies. [1]. These autoimmune disorders affect approximately 2% to 5% of the global population and notably high prevalence observed in females (5%–15%) compared to males (1%–5%) [2]. GD represent an autoimmune thyroid gland disorder, recognized by the presence of circulating immunoglobulins directed against thyroid stimulating hormone receptor (TSH-R). These autoantibodies cause excessive thyroid hormone production and the clinical manifestation through persistent activation of the receptors. [3]. Clinically, GD is presented by the occurrence of circulating antithyroid antibodies (ATA), thyrotoxicosis along with the detection of the infiltration of autoreactive lymphocytes into the thyroid gland, resulting an underlying autoimmune reaction. [4]. GD related systemic symptoms represent anxiety, fatigue, weakness, palpitations, diaphoresis, weight loss, and nervousness, it may involve extrathyroidal manifestations including autoimmune-related complications such as pretibial myxedema, thyroid-associated orbitopathy (TAO). [5] Cytokines are essential mediators in immune regulation and thyroid follicular cell modulation, playing a vital role in contributing to both the initiation and progression of inflammatory responses in GD. The most important pro-inflammatory cytokines like gamma interferon (INF-γ), is secreted by infiltrating immune cells and thyroid follicular cells within the inflamed gland [6]. In addition to inflammatory responses, these pro-inflammatory cytokines have a crucial role in orchestrating the recruitment and activation of immune effector cells to sites of tissue injury, augmenting the autoimmune reaction in GD [7]. Epigenetics serves as a crucial mediator in integrating genetic and environmental influences,      offering       insights     into   gene expression regulation without modulating the DNA sequence. The most significant epigenetic mechanisms implicated in the pathogenesis of AITD include X-chromosome inactivation, methylation of DNA, non-coding RNAs and histone modifications [8]. Aberrant DNA methylation affects both immune-related and thyroid-specific genes in GD, with hypomethylation of immune-associated genes promoting the production of thyroid-stimulating antibodies. Although studies on DNA methylation in AITD are limited and heterogeneous, they collectively support a significant role for abnormal methylation patterns in disease pathogenesis. [9]. .The primary objective of current investigation was to comprehensively evaluate the serum concentration of pro-inflammatory cytokin INF-γ, In addition to immunophenotyping, the study also aimed to investigate the epigenetic regulation of these INF-γ by assessing the DNA methylation status within the promoter regions of their corresponding gene in patients diagnosed with GD in Diwaniya City/ Iraq.

 


 

Table 1: Primers Utilized Current This Study

GenesPrimer Type

Nucleotide Sequences

Size (Bp)
INF- γMFAAGAGTTAATATTTTATTAGGGCGA

155

RTAAACTCCTTAAATCCTTTAACGAT
UF TGAAGAGTTAATATTTTATTAGGGTGA

157

RTAAACTCCTTAAATCCTTTAACAAT

GABDH

Internal

control

FTCTGACTTCAACAGCGACAC

76

RTGACAAAGTGGTCGTTGAGG

 

MATERIALS AND METHODS

Sample Collection

The study population consists of two groups:42 patients clinically diagnosed with GD and 38 healthy control individuals, all recruited from private endocrinology and oncology clinics in Diwaniya city between November 2023 and May 2024. Patients were diagnosed based on clinical evaluations performed by endocrinologist and oncologist and further confirmed through laboratory parameters, including elevated levels of Anti-Thyroid Peroxidase (TPO) antibodies and suppressed Thyroid Stimulating Hormone (TSH). 

 

Evaluation of TPO and TSH

Blood samples collected from GD patients were first centrifuged to separate the serum from cellular components. The serum was then aliquoted and stored at -20°C until analysis to maintain sample integrity. Prior to testing, the samples were thawed to room temperature and gently mixed to ensure homogeneity.) used in the present study to evaluate TPO and TSH using VIDUS® T4 and VIDUS® Anti-TPO kits (BIOMRIEUX/ France) by VIDUS system (BIOMRIEUX/ France).

 

Evaluation of Interferon- γ (IFN-γ) levels

ELISA method was performed for determination of INF -γ levels in serum samples. this kid was provided by used Interleukin- INF- γ ELISA-Kit (Elabscience. USA).

 

Extraction of the Genomic DNA

Blood samples genomic DNA is harvested through using of g-SYAN DNA (Frozen Blood) kit manufactured by Geneaid- USA, and conducted as manufacture

Methylation Percentage Quantification and PCR Condition

Methyl specific qPCR (MSP) method used in the present study for Quantification of methylation percentage in promoters of the interleukin relative to internal control (GAPDH) after Bisulfite conversion of the extracted DNA using MethylEdgeTM Bisulfite Conversion System kit (Promega/ USA). Master mix of qPCR is conducted by using Master Mix kit (Go Taq® qPCR) depending on SYBER-Green identification of amplified gene which designed through data base of NCBI Gene Bank and MethPrimer online software (www.urogene.org/methprimer/index1.html). Primers for each gene included two sets of primers, M for methylated cites and U for unmethylated cites in the promotor,table (1). Promotor sequences obtained from Eukaryotes Promoter Database (EPD), https://epd.expasy.org/epd/ .Primers obtained from (ScientificResearcher. Co. Ltd. Iraq). Methylation percentage calculated as the following equation:

 

RESULTS

Demographic Characterization

The present showed that the patient group consisted of 31(73.80%) females and 11(26.20%) males totaling 42 participants; male to female ratio is 0.35/1. In the control group, there were 23 (60.52%) females and 15 (39.48%) males, resulting in a total of 38 participants, Table 2. Statistical analysis confirming the difference between patients and controls observed non-significant.

 

 

Table 2: Sex Distribution of Graves’ Disease and Healthy Control Group

GroupFemale Male Totalp-value*
Patient31(73.80%)11(26.20%)42

0.205

(NS)**

Control23(60.52%)15(39.48%)38
Total542680

*= Pearson Chi-Square Test With 0.05 Significance Level, ** Non- Significant

 

Sex distribution was a key demographic variable assessed in GD patients, given the well-documented sex-related differences in autoimmune thyroid diseases, particularly the higher prevalence observed in females. Autoimmune conditions such as GD are known to exhibit a strong gender bias, often attributed to a combination of hormonal, genetic, and immune regulatory factors that differ between males and females [10]. In line with epidemiological trends reported worldwide, including Iraq, the patient cohorts demonstrated a pronounced female predominance, consistent with the broader understanding of GD being more commonly diagnosed in women, the present results aligned with local and international studies that demonstrated high predominance of female in GD [11-15].

 

The demographic characteristics of the study classified age into five groups, results revealed a comparative distribution between the patient and control groups as showed in Table 3. Among the 80 participants, the patient group (n = 42) comprised 6 individuals were <20 years, 13 in the 20–29 years category, 8 in both 30–39 and 40–49 years categories, and 7 aged above 50 years. In contrast, the control group (n = 38) included 3, 10, 11, 5, and 9 individuals in the respective age categories. There is non-significant variation between patients and controls in age distribution as indicated by statistical analysis, (p = 0.624). Non-significant variation in age distribution between patient and control group supports the suitability of group matching which decrease confusing potential in the comparisons. In current study, the age distribution of GD patients aligns with local and universal established epidemiological patterns, which indicates that the situation may appear in a wide age limit [16-18]. The GD is widely identified to demonstrate the beginning of a bimodal or variable age in various population, usually with young adulthood and peaks seen in a middle age, although it can occur at any standard of living. Initially, this variability can reflect the dynamics of the immune system, hormonal effects and the difference in environmental trigger throughout life. [19,20].

 

 

Table 3: Age Distribution of Graves’ Disease and Healthy Control Group

GroupAge GroupTotalp-value
<2020-2930-3940-49>50
Patient 61388742

0.624

(NS)

Control310115938
Total92319131680

Pearson Chi-Square Test With 0.05 Significance Level, NS = non-Significant

 

 

Evaluation of Thyroid Stimulating Hormone (TSH) and Thyroid Peroxidase Antibodies TPO

Our study showed, as indicated in table (4), that there is a significant difference between the patient and control groups in TSH and TPO levels. In the TSH measurement, the patient group exhibited a mean value of 0.462±0.398, In contrast, the control group, comprising 38 individuals, demonstrated a mean TSH level of 2.075±1.032, yielding a statistically significant, p-value of 0.001.

 

 

Table 4: Evaluation of TSH and TPO in Graves’ Disease and Healthy Control Group

VariablesGroupNMeanStd. DeviationMinimumMaximump-value
TSHPatient420.4620.3980.011.60

0.001

(S)

Control382.0751.0320.524.08
TPOPatient42159.39101.7420.17322.35

0.001

(S)

Control3822.1211.393.0736.98

Independent sample t-test with 0.05 Significance Level, S= Significant

 

 

Moreover, concerning TPO levels, the patient group again showed remarkable findings, with a mean of 159.39±101.74. This result also yielded a significant difference (p = 0.001). The control group, on the other hand, had a mean TPO level of 22.12±11.39, with a minimum of 3.07 and a maximum of 36.98. TSH suppression is a hallmark of hyperthyroidism, which is typically seen in GD. The significantly lower mean TSH levels in patients compared to controls suggest central downregulation of TSH due to elevated circulating thyroid hormones, a common pathophysiological mechanism in Graves’ disease [21]. On the other hand, anti-TPO antibodies are markers of autoimmune thyroiditis, their presence in elevated levels among Graves’ disease patients indicates underlying immune-mediated thyroid pathology, suggesting an overlap or coexistence of autoimmune mechanisms between the two conditions [22]. These findings align with established researches where TSH and anti- TPO antibody measurements are integral components of the diagnostic algorithm for autoimmune hyperthyroidism [23, 24].

 

Quantification of Interferon Gamma (INF-γ) Levels

The evaluation of INF-γ levels in the patient and control groups results is systematically organized in Table 5. The patient group demonstrated a mean INF- γ level of 432.49±53.22, while the control group exhibited a lower mean value of 401.58±64.08, Figure 1. Difference between the two groups was statistically significant, p-value 0.021. In GD, evaluation of IFN-γ levels underscores a crucial role for this cytokine in the immunopathology mechanisms in this disorder. IFN- γ, a hallmark cytokine of th1 cells, plays a central role in promoting cellular immunity and modifying antigen presentation, which includes effects on thyroid follicular cells that can affect autoimmune reactions [25]. Significant increased levels in IFN-γ in the patient group in current study supports the hypothesis that a Th1-polarized immune response may be included in the pathogenesis or perpetuation of the disease. Compared with other studies, current results agree with other studies indicating elevated IFN-γ in serum of patients with GD, conforming systemic immune activation [26-29].

 

 

Table 5: Levels of INF-γ Levels in Graves’ Disease and Healthy Control Group

MarkerGroupNMeanStd. DeviationP-value*
INF- γPatient42

432.488

53.220

 

0.021 (S)

Control38

401.575

64.081

Independent sample t-test with 0.05 Significance Level, S= Significant.

 

 

Figure 1: Mean of IFN- γ in Graves’ Disease Group and Control Group

 

 

Diagnostic Accuracy of IFN- γ

The diagnostic accuracy of IFN- γ was evaluated using a Receiver Operating Characteristic (ROC) curve analysis, with the aim of distinguishing between patients and healthy controls. Analysis conducted with a cut-off value for INF-γ at 438.44, Figure 2, Table 6. Individuals were categorized based on whether theirINF- γ levels fell below or above this threshold. Among the patient group, 19 individuals had INF-γ levels below the cut-off, compared to 26 in the control group, while 23 patients and 12 controls exhibited levels above the cut-off. The Area Under the Curve (AUC) was determined to be 0.638, with a 95% confidence interval (CI) ranging from 0.517 to 0.760, indicating poor diagnostic potential.

 

The sensitivity of the test, which measures the proportion of correctly identified patients, was notably low at 5.48%, whereas the specificity, representing the proportion of correctly identified controls, was 68.4%. These findings agree somewhat with those reported by Cheng et al., who highlighted the relevance of IFN-γ in modulating disease severity and thyroid-stimulating hormone receptor antibody (TSHR-Ab) titers in women with established GD, suggesting that while IFN-γ may play a role in disease pathophysiology or progression, its utility as a diagnostic tool remains limited [30]. On the other hand, a study by Rashad et al identified serum IFN-γ levels as sensitive and specific biomarkers for HD. suggesting that IFN-γ may play a crucial role in the pathogenesis and could serve as a reliable diagnostic biomarker of this condition [31]. This discrepancy underlines its role in GD, more complex, possibly reflects the severity of the disease rather than serving as a straight clinical tool.

 

 

 

Figure 2: ROC Curve of INF- γ Accuracy

 

DNA Methylation Percentage Quantification of INF-γ

The present study demonstrated variations between two groups methylation percentages in CpG sites of INF-γ promotor. In the GD group, the mean methylation percentage was recorded at 48.854, with a median value of 61.402 and an interquartile range (IQR) of 56.60. Conversely, the control group exhibited a higher mean methylation percentage of 58.67, with a median of 67.50 and a narrower IQR of 29.93. Statistical assessment indicated nonsignificant difference of the two groups, P-value 0.540, which exceeds the conventional threshold of 0.05 for statistical significance, table (7) and Figure (3).

 

The observed hypomethylation of the IFN-γ promoter in the studied group aligns with existing evidence that DNA methylation at CpG-rich regulatory regions has a critical effect in the lineage commitment and functional polarization of T-cells. Promoter hypomethylation is generally associated with increased chromatin accessibility and permissiveness for gene transcription, particularly in terminally differentiated effector T cells such as Th1 cells, which are characterized by high IFN-γ expression. The relatively lower mean methylation levels suggest a potential epigenetic priming or active state of the IFN-γ locus, which may reflect shifts in the composition or activation status of the Tcell pool. [32,33]. However, the lack of statistically significant differences between the groups indicates that, at the population level, the methylation profile of the IFN-γ promoter does not distinguish the studied cohort from controls. The finding of increased IQR range observed in IFN-γ promoter methylation suggests greater variability in methylation status which reflects variability in cellular composition, intrinsic immune activation states or environmental factors [34]. Rekha et al have shown a differential association of high and low producing alleles of IFN-γ with GD patients compared with controls [27], the study suggest that genetic and epigenetic factors may influence cytokine production and immune dysregulation. Collectively, our study the complexity of regulation in cytokine genes in autoimmune conditions, highlights the need to investigate both genetic and epigenetic mechanisms of immune cell function [35,36].

 

 

 

Figure 3: Box Plot of Median Comparison of DNA Methylation Percentages in CpG sites of INF-γ in Graves’ Disease and Healthy Control Group

 

 

 

Figure 4: ROC Curve of percentages of methylation in the promoter of IFN- γ

 

 

 

 

Table 6: Accuracy Characteristics of INF- γ

INF- γPatients n = 42Healthy Control n = 38
Cut off438.44
< 438.441926
> 438.442312
AUC (95% CI)0.638 (0.517- 0.760)
Sensitivity54.8 %
Specificity68.4 %

 

IFN- γ promoter methylation percentages Diagnostic Accuracy.

ROC curve conducted to velate the diagnostic accuracy of methylation percentages in the promoter region of studied cytokines. Results demonstrated that IL-17 ROC curve conducted at a methylation percentage cutoff value76.56. Individuals with methylation percentages above this threshold included 27 patients and 34 controls, while those with methylation percentages below the threshold consisted of 15 patients and 4 controls. The area under the ROC curve (AUC) was calculated to be 0.540, reflecting the overall poor ability of the methylation percentages as a biomarker. The sensitivity of the test, which indicates the proportion of correctly identified positive cases among patients, was found to be 0.333, whereas the specificity, representing the proportion of correctly identified negative cases among controls, was notably higher at 0.905, Table 8.

 

Table 7: Comparative Analysis INF-γ Promoter CpG Site Methylation Profiles in Graves’ Disease Patients Versus Healthy Controls

GroupMedianIQRp-value*
Graves’ Disease Patient 61.40256.60

0.540

(NS)**

Control 67.5029.93

M. Whitney U-test; NS = nonsignificant at p>0.05, IQR = Interquartile Range

 

Table 8: Diagnostic Accuracy Characteristics of methylation percentages in the promoter of IFN- γ

Methylation Percentages of the IFN- γ PromoterPatients  n =42Healthy Control n =38
Cut off76.56
<76.562734
>76.56154
AUC (95% CI)0.540 (0.279-0.617)
Sensitivity0.333
Specificity0.905

 

 

Comparable to the findings for certain interleukin genes, the analysis of DNA methylation in the IFN-γ promoter did not yield results that clearly differentiate between groups. Additionally, there is a lack of existing data available for comparison, making it difficult to place these findings within a broader epigenetic or immunological context. The limited discriminative potential of the methylation percentages suggests that, at least in this setting, promoter methylation alone may not be sufficient to serve as a robust biomarker.

CONCLUSION

It was observed that INF-γ levels are significantly elevated in patients with Graves’ disease (GD) compared to healthy controls. Furthermore, analysis of the methylation status of the INF-γ gene promoter revealed a trend toward hypomethylation in GD patients, suggesting potential epigenetic modulation of gene expression. However, the observed difference in methylation levels between the two groups did not achieve statistical significance, possibly due to limitations such as sample size or variability within the study population. Nevertheless, the consistent pattern of hypomethylation in conjunction with increased INF-γ expression implies that DNA methylation within the INF-γ promoter region may play a regulatory role in the pathogenesis of Graves’ disease, warranting further investigation into its functional implications.

REFERENCE
  1. Yoo W.S. and Chung H.K. "Two cases of graves' disease presented with atypical symptoms." International Journal of Thyroidology, vol. 9, no. 2, 2016, pp. 174-179.

  2. Najim M.K. et al."Association of serum apelin and atherogenic indices in patients with primary thyroid diseases." Eurasian Chemical Communications, vol. 5, no. 7, 2023, pp. 588-597.

  3. Zhou F. et al. "The VDR gene confers a genetic predisposition to Graves’ disease and Graves’ ophthalmopathy in the Southwest Chinese Han population." Gene, vol. 793, 2021, pp. 145750.

  4. Antonelli A. et al. "Graves’ disease: Epidemiology, genetic and environmental risk factors and viruses." Best Practice & Research Clinical Endocrinology & Metabolism, vol. 34, no. 1, 2020, pp. 101387.

  5. Khong J.J. et al."Risk factors for graves' orbitopathy; the Australian thyroid-associated orbitopathy research (ATOR) study." The Journal of Clinical Endocrinology & Metabolism, vol. 101, no. 7, 2016, pp. 2711-2720.

  6. Mikoś H. et al. "The role of the immune system and cytokines involved in the pathogenesis of autoimmune thyroid disease (AITD)." Endokrynologia Polska, vol. 65, no. 2, 2014, pp. 150-155.

  7. Ferrari S.M. et al."Chemokines in thyroid autoimmunity." Best Practice & Research Clinical Endocrinology & Metabolism, vol. 37, no. 2, 2023, p. 101773.

  8. Wang B. et al. "The emerging role of epigenetics in autoimmune thyroid diseases." Frontiers in Immunology, vol. 8, 2017, p. 396.

  9. Lafontaine N., Wilson S.G. and Walsh J.P. "DNA methylation in autoimmune thyroid disease." The Journal of Clinical Endocrinology & Metabolism, vol. 108, no. 3, 2023, pp. 604-613.

  10. Moroni L., Bianchi I. and Lleo A. "Geoepidemiology, gender and autoimmune disease." Autoimmunity Reviews, vol. 11, no. 6-7, 2012, pp. A386-A392.

  11. Layikh H.A., Hashim Z.A. and Kadhum A.A. "Eye manifestations in Iraqi patients with Graves’ disease." Pakistan Journal of Medical and Health Sciences, vol. 15, no. 4, 2021, pp. 1261-1264.

  12. Fawzi S.M., Abdul-Hassan I.A. and Mahdi B.M. "Intronic polymorphism of TSHR gene (rs179247) and its role in the susceptibility to graves' disease in a sample of Iraqi patients." Journal of Pharmaceutical Sciences and Research, vol. 10, no. 8, 2018, pp. 2003-2006.

  13. Mazeh H. et al. "In patients with thyroid cancer of follicular cell origin, a family history of nonmedullary thyroid cancer in one first-degree relative is associated with more aggressive disease." Thyroid, vol. 22, no. 1, 2012, p. 38.

  14. Thewjitcharoen Y. et al. "Practice patterns and outcomes in the management of Thai patients with Graves’ disease." Thyroid Research, vol. 14, 2021, pp. 1-8.

  15. Goichot B., Bouée S., Castello-Bridoux C. and Caron P. "Survey of clinical practice patterns in the management of 992 hyperthyroid patients in France." European Thyroid Journal, vol. 6, no. 3, 2017, pp. 152-159.

  16. Ibrahim H.Y., Sulaiman G.M., Al-Shammaa M.S. and Ad'hiah A.H. "Evaluation of interleukins 37 and 38 and vitamin D status in the serum of women with graves' disease." Journal of Clinical Laboratory Analysis, vol. 36, no. 12, 2022, p. e24776.

  17. Naser N.A.N. and Mahmood T.A. "Evaluation of proinflamation interleukin IL-6 in thyroid disorders patients in Najaf province." Medical Science Journal for Advance Research, vol. 5, no. 3, 2024.

  18. Elsherbiny T.M. "Characterization, treatment preferences, and outcomes of 390 Egyptian graves’ disease patients: A retrospective study." The Egyptian Journal of Internal Medicine, vol. 35, no. 1, 2023, p. 57.

  19. Sarfo-Kantanka O. et al. "Graves disease in Central Ghana: Clinical characteristics and associated factors." Clinical Medicine Insights: Endocrinology and Diabetes, vol. 11, 2018, p. 1179551418759076.

  20. Thewjitcharoen Y. et al. "Practice patterns and outcomes in the management of Thai patients with Graves’ disease." Thyroid Research, vol. 14, 2021, pp. 1-8.

  21. Garber J.R. et al."Clinical practice guidelines for hypothyroidism in adults: Cosponsored by the American Association of Clinical Endocrinologists and the American Thyroid Association." Endocrine Practice, vol. 18, no. 6, 2012, pp. 988-1028.

  22. Bartalena L. et al. "2018 European thyroid association (ETA) guidelines for the management of amiodarone-associated thyroid dysfunction." European Thyroid Journal, vol. 7, no. 2, 2018, pp. 55-66.

  23. Al-Mofarji S.T., Jasim H.M. and Mohammed S.B. "Association between TPO gene polymorphisms with susceptibility to hyperthyroidism." Biomedicine, vol. 43, no. 6, 2023, pp. 1744-1749.

  24. Akber N.T. and Yenzeel J.H. "Evaluation of some biochemical parameters in Iraqi patients with hyperthyroidism." Iraqi Journal of Biotechnology, vol. 22, no. 1, 2023.

  25. Rydzewska M. et al. "Role of the T and B lymphocytes in pathogenesis of autoimmune thyroid diseases." Thyroid Research, vol. 11, 2018, pp. 1-11.

  26. Cheng C.W. et al."Serum interferon levels associated with the disease activity in women with overt graves' disease." Cytokine, vol. 138, 2021, p. 155353.

  27. Rekha P.L., Ishaq M. and Valluri V. "A differential association of interferon‐γ high‐producing allele T and low‐producing allele A (+ 874 A/T) with Hashimoto's thyroiditis and graves’ disease." Scandinavian Journal of Immunology, vol. 64, no. 4, 2006, pp. 438-443.

  28. Al-Humaidi M.A. "Serum cytokines levels in graves' disease." Saudi Medical Journal, vol. 21, no. 7, 2000, pp. 639-644.

  29. Matsubayashi S. et al. "In vitro production of interferon‐gamma by peripheral blood from patients with graves' disease, Hashimoto's thyroiditis and rheumatoid arthritis." Clinical & Experimental Immunology, vol. 82, no. 1, 1990, pp. 63-68.

  30. Cheng C.W. et al."Serum interferon levels associated with the disease activity in women with overt graves' disease." Cytokine, vol. 138, 2021, p. 155353.

  31. Rashad N.M. et al."Circulatory Hsa_Circ_0007777 expression level as a predictive biomarker of thyroid dysfunction in patients with Hashimoto's thyroiditis." The Egyptian Journal of Hospital Medicine, vol. 84, no. 1, 2021, pp. 2480-2485.

  32. Zhu J., Yamane H. and Paul W.E. "Differentiation of effector CD4 T cell populations." Annual Review of Immunology, vol. 28, no. 1, 2010, pp. 445-489.

  33. Ballestar E., Sawalha A.H. and Lu Q. "Clinical value of DNA methylation markers in autoimmune rheumatic diseases." Nature Reviews Rheumatology, vol. 16, no. 9, 2020, pp. 514-524.

  34. Zhou Q. et al. "ASMdb: A comprehensive database for allele-specific DNA methylation in diverse organisms." Nucleic Acids Research, vol. 50, no. D1, 2022, pp. D60-D71.

  35. Cai Z. et al. "Atomic description of the immune complex involved in heparin-induced thrombocytopenia." Nature Communications, vol. 6, no. 1, 2015, p. 8277.

  36. Li N. et al. "The anti-inflammatory actions and mechanisms of acupuncture from acupoint to target organs via neuro-immune regulation." Journal of Inflammation Research, 2021, pp. 7191-7224.

Recommended Articles
Research Article
Identification of some Bacterial virulence factors of Staphylococcus aureus and Klebsiella pneumoniae
Download PDF
Research Article
Electrochemical Comparative Studies On The Redox Behavior Of Cu(II) And Cr(II) Before And After Interactions With Ciprofloxacin In Solutions
Published: 10/08/2021
Download PDF
Research Article
Generic vs. Branded: Exploring Awareness, Perceptions, and Preferences for Generic Medicines among the People of Mandi
Published: 05/04/2025
Download PDF
Research Article
In Acute Appendicitis, Neutrophil/Lymphocyte Rate and C-Reactive Protein’s Radiological Relation with Appendix Diameter and İnvestigation of İts İmpact on The Diagnosis
Published: 10/03/2021
Download PDF
Chat on WhatsApp
Flowbite Logo
PO Box 101, Nakuru
Kenya.
Email: office@iarconsortium.org

Editorial Office:
J.L Bhavan, Near Radison Blu Hotel,
Jalukbari, Guwahati-India
Useful Links
Order Hard Copy
Privacy policy
Terms and Conditions
Refund Policy
Shipping Policy
Others
About Us
Contact Us
Online Payments
Join as Editor
Join as Reviewer
Subscribe to our Newsletter
+91 60029-93949
Follow us
MOST SEARCHED KEYWORDS
Copyright © iARCON International LLP . All Rights Reserved.