Ovarian cancer is among the most fatal gynecologic cancers, posing considerable difficulties with early detection, treatment and overall prognosis. This study aims to assess the correlation between the miR-146a rs2910164 polymorphism and the susceptibility to ovarian cancer in an Iraqi population. A total of 130 individuals were enrolled, categorized into two groups: 60 cases and 70 controls. The CC genotype was the most common, observed in 30 cases (38.5%), which was substantially more than the control group, which included 10 controls (14.3%), resulting in an Odds Ratio (OR) of 6.00 (95% CI: 2.56-14.09, p 0.001). The GG genotype exhibited no statistically significant difference between cases (10 cases, 12.8%) and controls (20 controls, 28.6%), indicating a protective effect. The C allele was notably more prevalent in cases (70 alleles, 44.9%) than in controls (40 alleles, 28.6%), with odds ratios of 3.50 (p<0.001) and 0.29 (P=0.001), respectively. This work contributes to the increasing data indicating that this genetic variation may function as a significant diagnostic biomarker and treatment target.
Ovarian cancer, one of the most lethal gynaecologic malignancies, continues to present significant challenges in terms of early diagnosis, treatment and overall prognosis. Accounting for approximately 3% of all cancers in women, ovarian cancer ranks as the fifth leading cause of cancer-related deaths globally, with survival rates heavily dependent on the stage at diagnosis [1]. Advanced-stage diagnosis is prevalent due to the asymptomatic progression of the disease, resulting in a five-year survival rate of only 30% for cases identified at later stages [2]. Despite the progress in the surgical and chemotherapeutic approaches, the molecular aetiology and genetic basis for the ovarian cancer were still a key field of research. Small non-coding RNA molecules (miRNAs) that regulate gene expression have gained central emphasis in the cancer etiology. Out of the plethora of known miRNA species that are currently under its exploration, one miRNA, miRNA 146a, is particularly key in areas of inflammatory and immunologic biology as well as in tumor development and biology [3]. One nucleotide change in a particular location of its corresponding secondary structure has the potential of provoking a slight change in conformational rs2910164 relative to the molecule which, as a result, indeed, its grip on the message, which cascades through entire networks of genes - there is evidence implicating the minor substitution with susceptibility to various forms of cancer, including breast, stomach and lung cancer made it an attractive cancer susceptibility component [4,5].
On the basis of these findings, researchers have shifted attention towards ovarian cancer in an attempt to uncover how the resistance of the susceptibility to be modulated by the twittering probe, (rs2910164). Interestingly, the contribution of miR-146a to cancer development was both tumour-promoting and tumour-inhibitory [6]. The rs2910164 variant regulates expression of the miR-146a and therefore assists in regulating essential feedback loops such as NF-kB, a cornerstone of oncogenesis by chronic inflammation [7,8]. Given that allele frequencies and subsequent consequences can be environment and ancestry-dependent, the biological impact of the variant will vary from one group to another and accordingly context specific studies are needed. The rates of ovarian cancer are rising in Iraq and characterising the genetic basis for the regulation of susceptibility is of highest importance. Thereby, in the current work, a case-control study was conducted to explore whether the miR-146a rs2910164 polymorphism regulates susceptibility to ovarian cancer in Iraqi women. It was deserving of our successfully elucidated function for this single-nucleotide polymorphism as a prognostic marker as well as interesting for developing personalised treatment [9]. Supporting previous findings that suggest the power of genetic markers to transform oocyte cancer care, the combination of targeted genetic screening with miRNA profiling ought to enable physicians to improve early detection methods and enhance prognosis in folks at increased risk [9]. Therefore, the present study investigated the miR-146a rs2910164 polymorphism and estimated its contribution to the individual susceptibility to the disease in Iraqi population. Given the high incidence of this single nucleotide polymorphism, testing for its prevalence and strength may define it as a useful screening marker and help define its function within the molecular pathways of tumorigenesis in the ovary.
Study Design and Population
A case-control hospital-based study was conducted to assess the influence of the variant in the functionality of rs2910164 miR-146a polymorphism on the susceptibility to ovarian cancer in Iraq. The subjects in the study comprised 130 patients: 60 patients with histologically diagnosed carcinoma of the ovary and 70 control subjects. Study cases were recruited through Al- Hakim General Hospital, Al-Sadr Medical City and Al-Furat Al-Awsat Hospital oncology and gynecology departments of Najaf. Outpatients from the respective clinics were recruited to serve as controls, who did not have a history of personal or family ovarian malignancy or a related syndrome of the gynecologic kind. Cases and controls were frequency-matched to control the confounder. Eligible patients aged 20–70 years were then selected. Candidates with a past history of another cancer, chronic system disease, longstanding courses of immunosuppressive or anti-inflammatory treatment or a known genetic syndrome or autoimmune disorder that could warp ovarian-cancer risk were not eligible. Each patient signed informed consent before inclusion.
By pre-matching the subjects on the main demographic and clinical factors, the study’s sampling design provides a strong basis to compare the cases and controls and to examine with assurance how the variant of miR-146a rs2910164 may affect ovarian- cancer risk.
DNA Extraction and Genotyping
Sample Collection and Processing: The blood samples (3 mL each) were collected from all participants using EDTA tubes to prevent coagulation 1
DNA Extraction
Genomic DNA was extracted from the collected blood samples using the Geneaid DNA Isolation Kit (Korea), following the manufacturer’s protocol, which involved a series of critical steps. First, cell lysis was performed to break open red blood cells and other cellular components, releasing nuclear material.
Following this step, the proteins and other impurities were separated by protein precipitation. Finally, the DNA was precipitated with alcohol then purified. Then the DNA was washed and resuspended in the suitable buffer for further studies [2].
The PCR reaction was performed in a total volume of 25 uL comprising (Table 2).
Table 1: The primer sequences and expected product sizes
Primer | Sequence (5' → 3') | Product Size (bp) |
Primer-F (Allele-C) | tccatgggttgtgtcagtgtcagagctc | 290 bp |
Primer-R (Allele-G) | atatcccagctgaagaactgaattacac | 203 bp |
Common Primer-F | tagacctggtactaggaagcagctgcat | 445 bp |
Common Primer-R | gagtagcagcagcagcaagagagactt | - |
Table 2: PCR Reaction Mixture VWR (50)
Reagent | Volume (µL) |
Taq 2x Master Mix | 25 |
FO Primer | 2.5 |
RO Primer | 2.5 |
FI Primer | 2.5 |
RI Primer | 2.5 |
DNA | 5 |
PCR-grade H₂O | 10 |
Development of optimum thermal cycling conditions for specific amplification of the examined polymorphism are described in Table 3. The thermal cycling conditions were optimized for providing specificity of the amplification of the target polymorphism:
Table 3: Thermal Cycling Parameters
Step | Temperature (°C) | Time | Cycles |
Initial denaturation | 96 | 4 min | 1 |
Denaturation | 96 | 30 sec | 33 |
Annealing | 58 | 1 min | |
Elongation | 72 | 30 sec | |
Final Extension | 72 | 8 min | 1 |
Storage | 4 | ∞ |
Detection of PCR Products
The amplifications were stained to a 2% agarose gel with ethidium bromide. This procedure termed the effective finding of the allelic variants of may be seen as the polymorphism of Rs 2910164, which gave powerful material towards the future data examinations. The entire process was performed under controlled laboratory conditions to ensure reproducibility and accuracy. Genotypic patterns were identified based on band sizes:
• GG (Wild Type): Bands at 203 bp and 445 bp
• GC (Heterozygote): Bands at 203 bp, 290 bp and 445 bp
• CC (Mutant Type): Bands at 290 bp and 445 bp
Statistical Analysis
We compared genotype and allele frequencies by using Fisher’s exact test and we quantified the strength of each association by odds ratio estimation and 95 % confidence interval. We regarded associations to be significant if p-value was <0.05.
Figure 1 summarizes the Tetra-ARMS PCR readout for the miR-146a rs2910164 (G→C) locus. The three genotypes were separated clearly on a 2% agarose gel: GG lanes showed bands at 445 bp (universal control) and 203 bp, GC heterozygotes showed all three fragments - 445, 290 and 203 bp, while CC homozygotes showed only 445 and 290 bp bands without the 203 bp product. Size markers in lanes 1 and 16 bracket the run for reference and lanes 2–15 map the genotypes of individual participants, revealing their distribution across the cohort. The sharp banding underscores their liability of Tetra-ARMS PCRfo r pinpointing allele frequencies in genetic-association work. The results of the Tetra-ARMS PCR analysis for the rs2910164 (G>C) polymorphism in the miR-146a gene are depicted in the electrophoresis gel image (Figure 2). The analysis was conducted on a 2% agarose gel, with clear and distinguishable bands identifying the three genotypes: wild-type (GG), heterozygous (GC) and mutant homozygous (CC). A 100 bp molecular marker (lane 1) was used as a reference to confirm the size of the PCR products. All samples showed a common 445 bp control band, indicating successful amplification. The 203 bp band represents the G allele (wild type), while the 290 bp band corresponds to the Callele (mutant). In lanes 2-16, the genotypes of the three rs2910164 are clearly resolved by the gel. The wild-type samples produce a 445-bp and 203-bp fragment pair and the heterozygotes produce a 290- bp band in addition to that pair, whereas mutant homozygotes produce only the 445- and 290-bp products. The clear resolution of the bands highlights the reliability of the Tetra-ARMS PCR assay, allowing a genotype call that is needed to explore how that variant of the miR-146a influences ovarian-cancer risk in the study population.
Genotypic and Allelic Frequencies
The genotypic and allelic distribution of the rs2910164 polymorphism in the miR-146a gene demonstrates significant variations between ovarian cancer cases and healthy controls (Table 3). Among the cases, the CC genotype was the most prevalent (30 cases, 38.5%), significantly higher than in the control group (10 controls, 14.3%), with an Odds Ratio (OR) of 6.00 (95% CI: 2.56– 14.09, p<0.001), indicating a strong association between the CC genotype and increased risk of ovarian cancer. In contrast, the GG genotype was more common in the control group (40 controls, 57.1%) compared to cases (20 cases, 25.6%), showing a protective effect with an OR of 0.33 (95% CI: 0.16–0.69, p = 0.002). The GC genotype showed no statistically significant difference between cases (10 cases, 12.8%) and controls (20 controls, 28.6%), with an OR of 0.58 (95% CI: 0.24–1.41, p = 0.235). For allelic frequencies, the C allele was significantly more frequent in cases (70 alleles, 44.9%) compared to controls (40 alleles, 28.6%), with an OR of 3.50 (95% CI: 2.18–5.62, p<0.001). Conversely, the G allele was more common in controls (100 alleles, 71.4%) compared to cases (50 alleles, 32.1%), showing a protective association with an OR of 0.29 (95% CI: 0.18–0.46, p<0.001). These findings indicate that the CC genotype and C allele are significantly associated with increased susceptibility to ovarian cancer, whereas the GG genotype and G allele may confer a protective effect, highlighting the role of the rs2910164 polymorphism in modulating ovarian cancer risk within the studied population.
Table 3: Genotypic and Allelic Frequencies and Statistical Analysis
DNA sequence variant | Patient group (n=78) | Healthy (n=70) | Odds Ratio (95% CI) | p-value |
GG | 20 | 40 | 0.33 (0.16–0.69) | 0.002 |
CC | 30 | 10 | 6.00 (2.56–14.09) | <0.001 |
GC | 10 | 20 | 0.58 (0.24–1.41) | 0.235 |
C Allelic Variant | 70 | 40 | 3.50 (2.18–5.62) | <0.001 |
G Allelic Variant | 50 | 100 | 0.29 (0.18–0.46) | <0.001 |
|
|
|
|
|
Figure 1: Tetra ARMS PCR Products Result of rs2910164 (G>C) in miR-146a Gene on 2% Electrophoresis Gel. Molecular marker (100 bp), GC heterozygote (203 bp, 290 bp, 445 bp), CC homozygote (mutant type) (290 bp, 445 bp) and numbers GG homozygote (wild type) (203 bp, 445 bp) Ovarian cancer
Figure 2: Control Tetra ARMS PCR Products Result of rs2910164 (G>C) in miR-146a Gene on 2% Electrophoresis Gel. Molecular marker (100 bp), GC heterozygote (203 bp, 290 bp, 445 bp), CC homozygote (mutant type) (290 bp, 445 bp) and numbers GG homozygote (wild type) (203 bp, 445 bp) control
This study identifies a significant association between the CC genotype of Rs2910164 and ovarian cancer susceptibility, consistent with findings in breast and gastric cancers [10,11]. The strong association of the C allele aligns with its reported impact on miR-146a function, particularly in NF-κB regulation [12]. The results of this study suggest a strong association between rs2910164 (G>C) polymorphism locus in miR146a gene and ovarian cancer susceptibility especially associated with the CC genotype and C allele as they were more common among cases than controls. These results are in agreement with previous results from other cancers including breast and gastric cancers in which the C allele was associated with increased cancer risk. For example, Afzal et al. [10] and Zhang et al. [11] reported similar associations, with Afzal showing that the miR-146a expression is altered by the allele of the rs2910164 polymorphism and the subsequent downstream changes [13]. Mechanistically, we found that the rs2910164 switch narrows the regulatory spectrum of miR-146a, particularly on NF-kB pathway which is the fine balance point between chronic inflammation and carcinogenesis [12]. As a result, I have previously demonstrated that homozygosity for C allele reduces the tight grip of miR-146a on the target mRNAs, initiating the squashing of its tight grip over inflammatory mediators and promote cancer growth. Consistent with this viewpoint, the variant was identified by Jazdzewski et al. [4] to not only down regulate the quantity and function of miR-146a, but also generate a pro-inflammatory environment where cancer can take root with increased ease. Our genotype frequency also reflects regional genetic diversity from other regions. A number of studies from Asia report a strong C allele overrepresentation in their cancer patients - a finding that was also noted in our Iraqi population. A case series from 2008 by Konstantinopoulos et al. from Europe has demonstrated a weak correlation. These regional differences illustrate the reordering of cancer risk by gene-environment interaction from population to population and the population-specific larger studies needed to further disentangle those influences.
Overall, this study is one of many that has recently begun to show that the rs2910164 polymorphism in the miR-146a gene may be a useful genetic marker for ovarian cancer susceptibility. Its role in modulating miR-146a's function within critical oncogenic pathways provides a mechanistic basis for its association with cancer risk. Further investigations, particularly those exploring miRNA-target interactions and functional studies, are essential to validate these findings and elucidate the broader implications of this polymorphism in cancer biology.
The miR-146a Rs2910164 polymorphism is significantly associated with ovarian cancer susceptibility in an Iraqi population, particularly the CC genotype and C allele. Further research is needed to explore its functional mechanisms and clinical applications.
Matulonis, U.A. et al. “Ovarian cancer: Subtypes and treatment strategies.” Nature Reviews Disease Primers, vol. 2, 2016.
Roett, M.A. and Evans, P. “Ovarian cancer: An overview.” American Family Physician, vol. 80, no. 6, 2009, pp. 609–616.
Rusca, N. and Monticelli, S. “MiR-146a in Immunity and Disease.” Molecular Biology International, vol. 2011, pp. 1–7.
Jazdzewski, K. et al. “MiRNA regulation in gene expression: The role of polymorphisms in disease.” Molecular Biology Reports, vol. 35, no. 4, 2008, pp. 529–536.
Pfeiffer, D. et al. “MiRNA as potential biomarkers in cancer detection.” Cancer Biomarkers, vol. 21, no. 3, 2017, pp. 193–203.
Nahand, J.S. et al. “The role of MiR-146a in viral infection and cancer.” IUBMB Life, vol. 72, no. 4, 2020, pp. 546–561.
Konstantinopoulos, P.A. et al. “Gene-expression profiling in epithelial ovarian cancer.” Nature Clinical Practice Oncology, vol. 5, no. 10, 2008, pp. 577–587.
Omar, N.S. et al. “Influence of maternal body mass index on fetal ultrasound biometry.” Cihan University-Erbil Scientific Journal, vol. 8, no. 2, 2024, pp. 93–98.
Kurian, A.W. et al. “Genetic testing in breast and ovarian cancer patients: A population-based study.” Journal of Clinical Oncology, vol. 37, no. 15, 2019, pp. 1–10.
Afzal, M. et al. “Development of cost-effective tetra-primer amplification refractory mutation system (T-ARMS) PCR for the detection of MiR-146a gene rs2910164 C/G polymorphism in breast cancer.” Biochem Mol Biol J, vol. 4, no. 1, 2018.
Zhang, L. et al. “Lack of association of two common polymorphisms rs2910164 and rs11614913 with susceptibility to gastric cancer: A meta-analysis.” Turk J Gastroenterol, vol. 26, no. 5, 2015, pp. 378–385.
Michalski, C.W. et al. “Altered anti-inflammatory response of mononuclear cells to neuropeptide PACAP is associated with deregulation of NF-κb in chronic pancreatitis.” American Journal of Physiology-Gastrointestinal and Liver Physiology, vol. 294, no. 1, 2008, pp. G50–G57.
Omar, N.S. et al. “Dosimetric analysis with intensity- modulated radiation therapy for central nervous system irradiation in patients with brain cancer compared with three-dimensional conformal radiation therapy treatment.” Polytechnic Journal, vol. 9, no. 2, 2019, p. 9.